Sequence ID | >W1610623823 |
Genome ID | LHXU01000091 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | candidate division MSBL1 archaeon SCGC-AAA259M10 MSBL1 archaeon SCGC-AAA259M10 [LHXU] |
Start position on genome | 276 |
End posion on genome | 346 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ggcccgctga |
tRNA gene sequence |
GGGTCCATGGTCCATCGGTAAGACGCTACCCTGACGTGGTAGAGAGGAAGGTTCAACTCC |
Downstream region at tRNA end position |
ctctaacggc |
Secondary structure (Cloverleaf model) | >W1610623823 Val GAC a Atcg ctctaacggc G - C G + T G - C T - A C - G C - G A - T T C T C T T C C A T A G | | | | | A C C C T G G A A G G C G | | | T T G A G A C T A G AGAG C - G T - A A - T C - G C - G C T T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |