Sequence ID | >W1610623844 |
Genome ID | LHXW01000005 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | candidate division MSBL1 archaeon SCGC-AAA261C02 MSBL1 archaeon SCGC-AAA261C02 [LHXW] |
Start position on genome | 627 |
End posion on genome | 714 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gccgtgattt |
tRNA gene sequence |
GCGGGGGTAACCAAGCCAGGTCAAAGGTGCCAGACTCAAGATCTGGTCCCGTAGGGGTTC |
Downstream region at tRNA end position |
cctgatttta |
Secondary structure (Cloverleaf model) | >W1610623844 Leu CAA t ACCA cctgatttta G - C C - G G - C G - C G - C G - C G - C T A T T T C C C A C C G A A | | | | | A A A C C A A A G G G C G | | | T T G A G G T T C A A G TCCCGTAGGGGTTC C - G C - G A - T G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |