Sequence ID | >W1610623854 |
Genome ID | LHXX01000010 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | candidate division MSBL1 archaeon SCGC-AAA261D19 MSBL1 archaeon SCGC-AAA261D19 [LHXX] |
Start position on genome | 4876 |
End posion on genome | 4804 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ccggtccatg |
tRNA gene sequence |
GGGCCCGTGGTCTAGTGGCTATGACGCCACCTTGACATGGTGGTAATCGAGGGTTCGAAT |
Downstream region at tRNA end position |
agcacagttc |
Secondary structure (Cloverleaf model) | >W1610623854 Val GAC g Atta agcacagttc G - C G - C G - C C - G C - G C - G G - C T A T C T C C C A T G A G | | | | | G G T C T G G A G G G C G | | | T T C T G A C T A G TAATC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |