Sequence ID | >W1610623891 |
Genome ID | LHYB01000042 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | candidate division MSBL1 archaeon SCGC-AAA261O19 MSBL1 archaeon SCGC-AAA261O19 [LHYB] |
Start position on genome | 369 |
End posion on genome | 282 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
catcagcact |
tRNA gene sequence |
GCGGGGGTAGCCAAGCATGGTCAAAGGCGCAGCGTTGAGGGCGCTGTCCCGTAGGGGTCC |
Downstream region at tRNA end position |
cgatttttgg |
Secondary structure (Cloverleaf model) | >W1610623891 Leu GAG t ACCA cgatttttgg G - C C - G G - C G - C G - C G - C G - C T A T C A C C C A A C G A A | | | | | G T A C C G G T G G G C G | | | T T G A G G C T C A A G TCCCGTAGGGGTCC C - G A - T G - C C - G G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |