Sequence ID | >W1610624141 |
Genome ID | LHZD01000020 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Gluconobacter oxydans [LHZD] |
Start position on genome | 2428 |
End posion on genome | 2504 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
cgccgtcggc |
tRNA gene sequence |
CGGAGTGTAGCTCAGCCTGGTAGAGCACTGTGTTCGGGACGCAGGGGCCGGAGGTTCGAA |
Downstream region at tRNA end position |
gccgataatt |
Secondary structure (Cloverleaf model) | >W1610624141 Pro CGG c ACCA gccgataatt C - G G - C G - C A - T G - C T - A G - C T A T T C T C C A C G A A + | | | | G C C T C G G G A G G C T | | | | T T G G A G C G T A A GGGCC C - G T - A G - C T + G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |