Sequence ID | >W1610625312 |
Genome ID | LIAL01000001 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Nitrosopumilus sp. BACL13 MAG-121220-bin23 [LIAL] |
Start position on genome | 29479 |
End posion on genome | 29384 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
taaattgatT |
tRNA gene sequence |
GGACCCGTCGTCTAGTTTGGTTTGGATGACGCACTCACACTGCGTAAGGAAGAAATTCCC |
Downstream region at tRNA end position |
ttttaattta |
Secondary structure (Cloverleaf model) | >W1610625312 Val CAC T ATta ttttaattta G - C G - C A - T C - G C - G C - G G - C T A T T A C C C A T T G A C + | | | | A T T C T G G T G G G C G + | | + T T G G G A T T T T G AAGGAAGAAATTCCCGCAAAGGTC A - T C - G G - C C - G A - T C C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |