Sequence ID | >W1610625691 |
Genome ID | LIAY01000145 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Microbacteriaceae bacterium BACL25 MAG-120322-bin65 [LIAY] |
Start position on genome | 885 |
End posion on genome | 960 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gagagccgtg |
tRNA gene sequence |
GTGGGTATAGCTCAGTTGGTAGAGCGCCTGGTTGTGGTCCAGGAGGCCGCGGGTTCAAGC |
Downstream region at tRNA end position |
agttttttcc |
Secondary structure (Cloverleaf model) | >W1610625691 His GTG g CCCA agttttttcc G - C T - A G - C G + T G - C T - A A - T C G T T G C C C A T G A A + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A G AGGCC C - G C - G T - A G - C G - C T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |