| Sequence ID | >W1610626563 |
| Genome ID | LICK01000004 |
| Phylum/Class | Bacteroidota |
| Species | Polaribacter sp. BACL8 MAG-120531-bin13 [LICK] |
| Start position on genome | 29253 |
| End posion on genome | 29179 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
gctgcaaacc |
| tRNA gene sequence |
GGTCCGTTCGTCTAGGGGTTAGGACGCCAGGTTTTCATCCTGGTAACAGGGGTTCGATTC |
| Downstream region at tRNA end position |
aagcgaatgg |
| Secondary structure (Cloverleaf model) | >W1610626563 Glu TTC
c ACAA aagcgaatgg
G + T
G - C
T - A
C - G
C - G
G - C
T - A T T
T T C C C C A
G G A C | | | | | G
G T C T G A G G G G C
G + | | | T T
T G G A C
T A G TAAC
C - G
C - G
A - T
G - C
G - C
T T
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |