Sequence ID | >W1610627114 |
Genome ID | LIDF01000012 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Cryomorphaceae bacterium BACL18 MAG-120507-bin74 [LIDF] |
Start position on genome | 2178 |
End posion on genome | 2252 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ccgctccacc |
tRNA gene sequence |
GCCGATGTAGCTCAGGGGTAGAGCGTTTCCTTGGTAAGGAAAAGGTCGCGGGTTCAATTC |
Downstream region at tRNA end position |
cgttcacagt |
Secondary structure (Cloverleaf model) | >W1610627114 Thr GGT c TCAA cgttcacagt G - C C - G C - G G + T A - T T - A G - C T T T C G C C C A G A A | | | | | A G C T C G G C G G G C G | | | | T T G G A G C T A G AGGTC T - A T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |