Sequence ID | >W1610627491 |
Genome ID | LIDT01000013 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Bacteroides fragilis [LIDT] |
Start position on genome | 165207 |
End posion on genome | 165281 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cgagaaacaa |
tRNA gene sequence |
GGTTCCTTGGATGAGTGGCTTAGTCAGCGGTCTGCAAAACCGTGTACGGCGGTTCGAATC |
Downstream region at tRNA end position |
acagcccaaa |
Secondary structure (Cloverleaf model) | >W1610627491 Cys GCA a TCAA acagcccaaa G - C G - C T - A T - A C - G C - G T - A T A T C C G C C A T G A G | | | | | G G G T A G G G C G G C G + | | T T C A G T C T T A GTAC G + T C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |