| Sequence ID | >W1610634670 |
| Genome ID | LISA01000002 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter coli [LISA] |
| Start position on genome | 227994 |
| End posion on genome | 227920 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
ttttctgagc |
| tRNA gene sequence |
GCTCGTATGGCTCAGAGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCGCGGGTTCAATTC |
| Downstream region at tRNA end position |
taaaattgaa |
| Secondary structure (Cloverleaf model) | >W1610634670 Thr GGT
c TCCA taaaattgaa
G - C
C - G
T - A
C - G
G + T
T - A
A - T T T
T C G C C C A
G A G | | | | | A
A C T C G G C G G G C
G | | | | T T
G G A G C
T A A AGGTC
C - G
T - A
C - G
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |