Sequence ID | >W1610635461 |
Genome ID | LITK01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas undina tetraodonis [LITK] |
Start position on genome | 844969 |
End posion on genome | 845053 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gcgttgcatt |
tRNA gene sequence |
GGAGGGGTTCCCGAGCGGCCAAAGGGATCAGACTGTAAATCTGACGGCTCAGCCTTCGCT |
Downstream region at tRNA end position |
cttttcttag |
Secondary structure (Cloverleaf model) | >W1610635461 Tyr GTA t ACCA cttttcttag G - C G - C A - T G - C G - C G - C G + T T A T C G A C C A C G A T | | | | | G G G C C C G C T G G C G | | | T T C A G G G C A A A CGGCTCAGCCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |