| Sequence ID | >W1610641825 |
| Genome ID | LJBT01000013 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus ferrooxidans [LJBT] |
| Start position on genome | 219134 |
| End posion on genome | 219210 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
tcatccctat |
| tRNA gene sequence |
GCGCCTGTAGCTCAACCGGATAGAGCAACGGCCTTCTAAGCCGTAGGTCAGGGGTTCGAG |
| Downstream region at tRNA end position |
aacaaaacaa |
| Secondary structure (Cloverleaf model) | >W1610641825 Arg TCT
t ACCA aacaaaacaa
G - C
C - G
G - C
C - G
C - G
T - A
G - C T G
T T T C C C A
C A A A | + | | | G
C C T C G A G G G G C
G | | | | T T
G G A G C
A T A A AGGTC
A - T
C - G
G - C
G - C
C - G
C A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |