Sequence ID | >W1610642316 |
Genome ID | LJCQ01000358 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Acidiplasma aeolicum V [LJCQ] |
Start position on genome | 5250 |
End posion on genome | 5333 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aatttgttat |
tRNA gene sequence |
GCCATGGTGGCCCAGTGGTACGGCGCCAGCCTTGAGAGCTGGTTCCCTTGTGGATCGGGA |
Downstream region at tRNA end position |
ttattttttt |
Secondary structure (Cloverleaf model) | >W1610642316 Ser TGA t GCTA ttattttttt G - C C - G C - G A - T T - A G - C G - C T A T C T C T C A G A G | + | | | G T C C C G G G G A G C G | | | T T G C G G C T A G TTCCCTTGTGGATC C - G C - G A - T G - C C - G C A T G T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |