Sequence ID | >W1610649305 |
Genome ID | LJHX01000080 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | alpha proteobacterium AAP81b [LJHX] |
Start position on genome | 8189 |
End posion on genome | 8103 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cctacctcgt |
tRNA gene sequence |
GCCCGGATGGCGGAATTGGTAGACGCACCAGCTTCAGGTGCTGGCGCTCGCAAGGGCGTG |
Downstream region at tRNA end position |
tttcgcgcaa |
Secondary structure (Cloverleaf model) | >W1610649305 Leu CAG t ACCA tttcgcgcaa G - C C - G C - G C - G G - C G - C A - T T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G A CGCTCGCAAGGGCGT C - G C - G A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |