Sequence ID | >W1610655375 |
Genome ID | LJNT01000192 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Rhodobacteraceae bacterium HLUCCA09 [LJNT] |
Start position on genome | 127 |
End posion on genome | 51 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
accctcgcgt |
tRNA gene sequence |
GCCGCCTTAGCTCAGTTGGTTAGAGCGCTAGATTGTGGATCTAGAGGTCGCCCGTTCGAT |
Downstream region at tRNA end position |
caaaatcgag |
Secondary structure (Cloverleaf model) | >W1610655375 His GTG t ACCA caaaatcgag G + T C - G C - G G - C C - G C - G T - A C T T C G G G C A T G A A | | | | | G T C T C G G C C C G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T G - C A - T T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |