Sequence ID | >W1610659180 |
Genome ID | LJQW01000151 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas savastanoi pv. nerii [LJQW] |
Start position on genome | 51467 |
End posion on genome | 51543 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggcctactga |
tRNA gene sequence |
GGGCCCATAGCTCAGTTGGTTAGAGCAGAGGACTCATAATCCTTTGGTCCACGGTTCGAG |
Downstream region at tRNA end position |
tactcaaagc |
Secondary structure (Cloverleaf model) | >W1610659180 Met CAT a ACCA tactcaaagc G - C G - C G - C C - G C - G C - G A - T T G T G T G C C A T G A A | | | | | G T C T C G C A C G G C G | | | | T T G G A G C T T A A TGGTC G + T A - T G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |