Sequence ID | >W1610660551 |
Genome ID | LJSF01000041 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Rhodobacteraceae bacterium HLUCCA08 [LJSF] |
Start position on genome | 108165 |
End posion on genome | 108089 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cgcacagagg |
tRNA gene sequence |
GCGGTTGTAGCTCAGTTGGTTAGAGTACCGGCCTGTCACGCCGGGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
cctttccccc |
Secondary structure (Cloverleaf model) | >W1610660551 Asp GTC g GCCA cctttccccc G - C C - G G - C G - C T - A T - A G - C C G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | + T T G G A G T T T A A GGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |