Sequence ID | >W1610662318 |
Genome ID | LJTJ01000015 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfobacterales bacterium SG8_35 [LJTJ] |
Start position on genome | 92 |
End posion on genome | 16 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ttgctatgtg |
tRNA gene sequence |
GTGAGCGTAGCTCAGCTGGTGGTAGCACCGGGTTGTGGCCTCGGCGGTCGTGGGTTCAAG |
Downstream region at tRNA end position |
gaaatgataa |
Secondary structure (Cloverleaf model) | >W1610662318 His GTG g CCCA gaaatgataa G - C T - A G - C A - T G - C C - G G - C T G T T A C C C A C G A A + | | | | A T C T C G G T G G G C G | | | T T G T A G C T G G A CGGTC C - G C - G G - C G + T G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |