Sequence ID | >W1610665987 |
Genome ID | LJXO01000005 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Helicobacter pylori [LJXO] |
Start position on genome | 17788 |
End posion on genome | 17712 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ttttatagat |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGCTAGAGCATCAGCCTTCCAAGCTGAGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
tttttaggat |
Secondary structure (Cloverleaf model) | >W1610665987 Gly TCC t TCCA tttttaggat G - C C - G G - C G - C G - C A - T A - T C G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C C T A A GGGTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |