Sequence ID | >W1610670238 |
Genome ID | LKAZ01000027 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcina flavescens E03.2 [LKAZ] |
Start position on genome | 22925 |
End posion on genome | 22850 |
Amino Acid | Pseudo |
Anticodon | GTG |
Upstream region at tRNA start position |
gacccctgtg |
tRNA gene sequence |
GCCGGGGTAGGGTAGAGGTCCATCCTGTGGCCCTGTGGAGGCTACGACCCGAGTTCGATT |
Downstream region at tRNA end position |
attatttttc |
Secondary structure (Cloverleaf model) | >W1610670238 Pseudo GTG g CCTA attatttttc G - C C - G C - G G - C G - C G - C G + T T T T G G C T C A A G A A | | | | | G G T G G G C C G A G C G | | + T T T T C C T C C A G CGAC T - A G + T G - C C - G C - G C A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |