Sequence ID | >W1610670266 |
Genome ID | LKAZ01000053 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcina flavescens E03.2 [LKAZ] |
Start position on genome | 104217 |
End posion on genome | 104303 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ggacgttagT |
tRNA gene sequence |
GCGAGGGTTGCCCAGCCAGGTCAAAGGCGATGGGTTTAGGACCCATTTTCGTAGGAATTC |
Downstream region at tRNA end position |
ttttcacaga |
Secondary structure (Cloverleaf model) | >W1610670266 Leu TAG T ATtc ttttcacaga G - C C - G G - C A - T G - C G - C G - C T A T C A C G C A C C G A T | | | | | G A C C C G G T G C G C G | | | T T G A G G C T C A A G TTTCGTAGGAATTC A - T T - A G - C G - C G - C T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |