Sequence ID | >W1610670453 |
Genome ID | LKBG01000043 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Acidiplasma aeolicum VT [LKBG] |
Start position on genome | 75 |
End posion on genome | 2 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
aaccttcacT |
tRNA gene sequence |
GGGCTCGTAGTCTAGTGGTATGATGTCTCCCTGACACGGAGGAGGTCACCGGTTCGAATC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >W1610670453 Val GAC T ATtn nnnnnnnnnn G - C G - C G - C C - G T + G C - G G - C T A T T G G C C A G A A | | | | | G T T C T G A C C G G C G | | + T T G T G A T T A G AGGTC T + G C - G T - A C - G C - G C C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |