Sequence ID | >W1610673985 |
Genome ID | LKGQ01000034 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas sp. P1-16-1b [LKGQ] |
Start position on genome | 17435 |
End posion on genome | 17359 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cataaacgat |
tRNA gene sequence |
TCCCCCTTAGCTCAGTTGGTTAGAGCGACGGACTGTTAATCCGCAGGTCCCCCGTTCGAG |
Downstream region at tRNA end position |
agtttatgtt |
Secondary structure (Cloverleaf model) | >W1610673985 Asn GTT t GCCA agtttatgtt T - A C - G C - G C - G C - G C - G T - A T G T G G G G C A T G A A | | | | | G T C T C G C C C C G C G | | | | T T G G A G C T T A G AGGTC A C C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |