Sequence ID | >W1610675794 |
Genome ID | LKIR01000135 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloparvum sedimenti DYS4 [LKIR] |
Start position on genome | 328690 |
End posion on genome | 328766 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cggaatgcga |
tRNA gene sequence |
GCCGCCTTAGCTCAGATTGGGAGAGCACTCGACTGAAGATCGAGCTGTCCCCCGTTCAAA |
Downstream region at tRNA end position |
tactcacggt |
Secondary structure (Cloverleaf model) | >W1610675794 Phe GAA a ATCA tactcacggt G - C C - G C - G G - C C - G C - G T - A T A T G G G G C A A G A A | | | | | A T C T C G C C C C G C T | | | | T T G G A G C G G A A CTGTC C - G T - A C - G G - C A - T C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |