Sequence ID | >W1610681012 |
Genome ID | LKLN01000008 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lactococcus lactis subsp. lactis [LKLN] |
Start position on genome | 146095 |
End posion on genome | 146023 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
atttatttta |
tRNA gene sequence |
GCCGTTGTAGCTCAGTCGGTAGAGCAGCACCATGGTAAGGTGAAGGTCGACAGTTCGATT |
Downstream region at tRNA end position |
tttttacagt |
Secondary structure (Cloverleaf model) | >W1610681012 Thr GGT a Ataa tttttacagt G - C C - G C - G G + T T - A T - A G - C T T T T T G T C A T G A A + | | | | G C C T C G G A C A G C G | | | | T T G G A G C T A A AGGTC G A C - G A - T C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |