Sequence ID | >W1610684875 |
Genome ID | LKQP01000002 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio parahaemolyticus [LKQP] |
Start position on genome | 5462 |
End posion on genome | 5387 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ccattctttt |
tRNA gene sequence |
GCCTCGATAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTCGTGTCGGTGGTTCGATT |
Downstream region at tRNA end position |
ttatttggtg |
Secondary structure (Cloverleaf model) | >W1610684875 Phe GAA t ACCA ttatttggtg G - C C - G C - G T - A C - G G - C A - T T T T C C G C C A T G A A | | + | | G C C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |