Sequence ID | >W1610686001 |
Genome ID | LKUE01000296 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfuromonas sp. SDB [LKUE] |
Start position on genome | 421 |
End posion on genome | 497 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aataataaat |
tRNA gene sequence |
AGGCCTGTAGCTCTAATTGGCAGAGCATCGGACTCCAAATCCGAGGGTTGTAGGTTCGAA |
Downstream region at tRNA end position |
gcattttagg |
Secondary structure (Cloverleaf model) | >W1610686001 Trp CCA t GCCA gcattttagg A - T G - C G - C C - G C - G T - A G - C T A T C A T C C A A A T A | | | | | G T C T C G G T A G G C T | | | | T T G G A G C G C A A GGGTT T - A C - G G - C G - C A - T C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |