| Sequence ID | >W1610690355 |
| Genome ID | LLEU01000013 |
| Phylum/Class | Acidobacteriota |
| Species | Acidobacteria bacterium OLB17 [LLEU] |
| Start position on genome | 1855 |
| End posion on genome | 1931 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
ctctttttat |
| tRNA gene sequence |
GCTCCCGTAGCTCAGCCGGATAGAGCAACAGCCTTCTAAGCTGTGGGCCGCAGGTTCGAG |
| Downstream region at tRNA end position |
gatcgagata |
| Secondary structure (Cloverleaf model) | >W1610690355 Arg TCT
t GCGA gatcgagata
G - C
C - G
T + G
C - G
C - G
C - G
G - C T G
T C G T C C A
C G A A | | | | | G
C C T C G G C A G G C
G | | | | T T
G G A G C
A T A A GGGCC
A - T
C - G
A - T
G - C
C - G
C A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |