Sequence ID | >W1610690470 |
Genome ID | LLEX01000250 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Porphyrobacter sp. HL-46 [LLEX] |
Start position on genome | 2265 |
End posion on genome | 2341 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ggggcgtgtg |
tRNA gene sequence |
GCGATCGTAGCTCAGTTGGTTAGAGCGCCGGTTTGTGGTACCGGAGGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
ttttcctccc |
Secondary structure (Cloverleaf model) | >W1610690470 His GTG g CCCA ttttcctccc G - C C - G G - C A - T T + G C - G G - C C G T T C C C C A T G A A + | | | | G T C T C G G G G G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C G - C T - A T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |