Sequence ID | >W1610716049 |
Genome ID | LLWC01000037 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Pseudovibrio hongkongensis [LLWC] |
Start position on genome | 38482 |
End posion on genome | 38393 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
acgcgctcaa |
tRNA gene sequence |
GGACACGTGGCCGAGTGGTCGAAGGCGCTCCCCTGCTAAGGGAGTAGGCCCGGAAGGGTC |
Downstream region at tRNA end position |
tcaatttcca |
Secondary structure (Cloverleaf model) | >W1610716049 Ser GCT a GCCA tcaatttcca G - C G - C A - T C - G A - T C - G G - C T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TAGGCCCGGAAGGGTCTC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |