Sequence ID | >W1610717919 |
Genome ID | LLYW01000008 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Thermococcus celericrescens DSM 17994 [LLYW] |
Start position on genome | 70085 |
End posion on genome | 69998 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gcctttgggt |
tRNA gene sequence |
GCGGGGGTTGCCGAGCCTGGTCAAAGGCGGTGGACTCAAGATCCACTCCCGCAGGGGTTC |
Downstream region at tRNA end position |
cagttccttc |
Secondary structure (Cloverleaf model) | >W1610717919 Leu CAA t ACTA cagttccttc G - C C - G G - C G - C G - C G - C G - C T A T T C C C C A C C G A T | | | | | A T G C C G A G G G G C G | | | T T G A G G C T C A A G TCCCGCAGGGGTTC G - C T - A G - C G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |