Sequence ID | >W1610724211 |
Genome ID | LMDY01000013 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Methylibium sp. Root1272 [LMDY] |
Start position on genome | 1776 |
End posion on genome | 1691 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ggctcgtccc |
tRNA gene sequence |
GGAGGGGTGCCCGAGTGGCTAAAGGGGGCAGACTGTAAATCTGTTGGCTTACGCCTACGC |
Downstream region at tRNA end position |
gggcgaactg |
Secondary structure (Cloverleaf model) | >W1610724211 Tyr GTA c ACCA gggcgaactg G - C G - C A - T G - C G - C G + T G - C T A T C G A C C A T G A G | | | | | G G G C C C G C T G G C G | | | T T C A G G G T A A G TGGCTTACGCCTAC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |