Sequence ID | >W1610725417 |
Genome ID | LMEV01000003 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Variovorax sp. Root473 [LMEV] |
Start position on genome | 27746 |
End posion on genome | 27659 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cgacggttcc |
tRNA gene sequence |
GGAGAGTTGGGTGAGTGGTTTAAACCAGCAGTCTTGAAAACTGCCGACGTGAAAGCGTCC |
Downstream region at tRNA end position |
gaatcaatct |
Secondary structure (Cloverleaf model) | >W1610725417 Ser TGA c GCCA gaatcaatct G - C G - C A - T G - C A - T G - C T - A T A T C A C T C A T G A G | | | | | G G G T G G G T G A G C G | | | T T T A A C C T T A A CGACGTGAAAGCGTCC G - C C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |