Sequence ID | >W1610725617 |
Genome ID | LMEZ01000001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacterium sp. Root135 [LMEZ] |
Start position on genome | 559369 |
End posion on genome | 559298 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
catggacaac |
tRNA gene sequence |
GCGGGTGTGGCTGAGTGGCTAGGCACCGGCCTGCAAAGCCGTTTACACGGGTTCGAATCC |
Downstream region at tRNA end position |
gttgctcagt |
Secondary structure (Cloverleaf model) | >W1610725617 Cys GCA c TCgc gttgctcagt G - C C - G G - C G - C G + T T - A G - C T A T T G C C C A G A G | | | | | G T G T C G A C G G G C G + | | T T G A G G C C T A TTAC C T C - G G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |