Sequence ID | >W1610727907 |
Genome ID | LMGT01000009 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Brevundimonas sp. Root608 [LMGT] |
Start position on genome | 26024 |
End posion on genome | 25950 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ctcagatcag |
tRNA gene sequence |
GCCGCCGTAGCTCAGTGGTAGAGCGCATCCTTGGTAAGGCTGAGGTCGTGGGTTCGATTC |
Downstream region at tRNA end position |
ctctgaaacc |
Secondary structure (Cloverleaf model) | >W1610727907 Thr GGT g ACCA ctctgaaacc G - C C - G C - G G - C C - G C - G G - C T T T C C C C C A G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A G AGGTC C - G A - T T C C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |