Sequence ID | >W1610730809 |
Genome ID | LMJC01000004 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Acidovorax sp. Root267 [LMJC] |
Start position on genome | 145557 |
End posion on genome | 145632 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccaaggtttt |
tRNA gene sequence |
GACCCCATCGTCTAGAGGCCTAGGACATCACCCTTTCACGGTGAGTACCGGGGTTCGAAT |
Downstream region at tRNA end position |
agttgtagcg |
Secondary structure (Cloverleaf model) | >W1610730809 Glu TTC t GCCA agttgtagcg G - C A - T C - G C - G C - G C - G A - T T A T G C C C C A A G A C | | | | | G G T C T G C G G G G C G + | | | T T C G G A C C T A A GTAC T - A C - G A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |