Sequence ID | >W1610734053 |
Genome ID | LMLL01000011 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas sp. Leaf58 [LMLL] |
Start position on genome | 216244 |
End posion on genome | 216169 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
accacttttt |
tRNA gene sequence |
AGGCTCGTAGCTCAGCTGGAAGAGCGCCTGGTTCTGACCCAGGAGGTCGTTGGTTCAACT |
Downstream region at tRNA end position |
catcgcagta |
Secondary structure (Cloverleaf model) | >W1610734053 Gln CTG t GCCA catcgcagta A C G - C G - C C - G T + G C - G G - C T C T C A A C C A C G A A | | | | | A T C T C G G T T G G C G | | | | T T G G A G C A A G AGGTC C - G C - G T - A G - C G - C T C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |