Sequence ID | >W1610736085 |
Genome ID | LMNA01000009 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Pseudorhodoferax sp. Leaf274 [LMNA] |
Start position on genome | 2631 |
End posion on genome | 2705 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tccgccgccg |
tRNA gene sequence |
CTCCTCGTAGTTCAATGGATAGAACGAGTGCCTCCTAAGCGCTAGATACAGGTTCGATTC |
Downstream region at tRNA end position |
gtaagtccct |
Secondary structure (Cloverleaf model) | >W1610736085 Arg CCT g ACCA gtaagtccct C - G T + G C - G C - G T - A C - G G - C T T T T G T C C A T A A A | | | | | G G C T T G A C A G G C G | | | | T T A G A A C T A G AGAT A - T G - C T + G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |