Sequence ID | >W1610737314 |
Genome ID | LMOA01000021 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas sp. Leaf127 [LMOA] |
Start position on genome | 450505 |
End posion on genome | 450578 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gagcgtttga |
tRNA gene sequence |
GGCCGAGTAGCAAAATGGTTATGCCGTGGATTGCAAATCCACTTACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
ctataaacaa |
Secondary structure (Cloverleaf model) | >W1610737314 Cys GCA a TCCA ctataaacaa G - C G - C C - G C - G G - C A - T G - C T T T C A G C C A A A A | | | | G T A A C G G C C G G C G | | | T T G A T G C T T C TTAC G - C T - A G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |