Sequence ID | >W1610739204 |
Genome ID | LMPP01000002 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rathayibacter sp. Leaf185 [LMPP] |
Start position on genome | 701812 |
End posion on genome | 701725 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ggtcgcgcct |
tRNA gene sequence |
GGAGGATTCGCCTAGTGGCCTATGGCGCACGCTTGGAAAGCGTGTTGGGTGAAAGCCCTC |
Downstream region at tRNA end position |
aacggcgtcg |
Secondary structure (Cloverleaf model) | >W1610739204 Ser GGA t GCCG aacggcgtcg G - C G - C A - T G - C G - C A - T T - A T A T C C C C C A T G A C | | | | | G G T C C G G G G G G C G | | | T T C T G G C C T A G TTGGGTGAAAGCCCTC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |