Sequence ID | >W1610740412 |
Genome ID | LMQQ01000001 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Methylophilus sp. Leaf414 [LMQQ] |
Start position on genome | 743954 |
End posion on genome | 744030 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tctttcaaat |
tRNA gene sequence |
GGTGATGTAGCTCAGCTGGTTAGAGCACAGGATTCATAATCCTGGGGTCGAGGGTTCAAG |
Downstream region at tRNA end position |
aaattttaaa |
Secondary structure (Cloverleaf model) | >W1610740412 Met CAT t ACCA aaattttaaa G - C G - C T - A G - C A - T T T G + T T G T C T C C C A C G A A | | | | | A T C T C G G A G G G C G | | | | T T G G A G C T T A A GGGTC C - G A - T G - C G - C A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |