Sequence ID | >W1610743199 |
Genome ID | LMSP01000037 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Paenibacillus sp. Soil787 [LMSP] |
Start position on genome | 8749 |
End posion on genome | 8674 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tatagcttaT |
tRNA gene sequence |
CGGGACGTAGCTCAGCTTGGTAGAGCACCTGCTTTGGGAGCAGGGGGTCGCATGTTCAAA |
Downstream region at tRNA end position |
acncgcgggc |
Secondary structure (Cloverleaf model) | >W1610743199 Pro TGG T ATag acncgcgggc C - G G - C G - C G - C A - T C - G G - C T A T T G T G C A C G A A + | | + | A T C T C G G C A T G C T | | | | T T G G A G C G T A A GGGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |