Sequence ID | >W1610743553 |
Genome ID | LMSX01000008 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Terrabacter sp. Soil811 [LMSX] |
Start position on genome | 331006 |
End posion on genome | 331081 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
acaaccgcaa |
tRNA gene sequence |
GGGGCTGTGGCGCAGCTGGTAGCGCACCTGCATGGCATGCAGGGGGTCAGGGGTTCGAGT |
Downstream region at tRNA end position |
aacgaagaag |
Secondary structure (Cloverleaf model) | >W1610743553 Ala GGC a ACCG aacgaagaag G - C G - C G + T G - C C - G T - A G - C T G T T C C C C A C G A G | | | | | G T C G C G A G G G G C G | | | | T T G G C G C T A A GGGTC C - G C - G T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |