Sequence ID | >W1610745068 |
Genome ID | LMVK01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Agrobacterium tumefaciens str. B6 [LMVK] |
Start position on genome | 512622 |
End posion on genome | 512698 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cgtttcatgt |
tRNA gene sequence |
GCGGTTGTAGCTCAGTTGGTTAGAGCGCAGGTTTGTGGCACCTGAGGTCGGTGGTTCGAC |
Downstream region at tRNA end position |
ttcccctctc |
Secondary structure (Cloverleaf model) | >W1610745068 His GTG t ACCA ttcccctctc G + T C - G G - C G - C T - A T - A G - C C C T T C A C C A T G A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T G - C G - C T - A T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |