| Sequence ID | >W1610749217 |
| Genome ID | LNAA01000002 |
| Phylum/Class | Cyanobacteriota |
| Species | Oscillatoriales cyanobacterium MTP1 [LNAA] |
| Start position on genome | 315183 |
| End posion on genome | 315102 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
gcgatgccgt |
| tRNA gene sequence |
GCGGAAGTGGCGAAATGGCAGACGCACCAGACTTAGGATCTGGCGCCGCAAGGCATGAGA |
| Downstream region at tRNA end position |
ctctgtcctg |
| Secondary structure (Cloverleaf model) | >W1610749217 Leu TAG
t ACtt ctctgtcctg
G - C
C - G
G - C
G - C
A - T
A - T
G - C T G
T C T C T C A
T A A G | | | | | G
G A G C G G A G A G C
G | | | T T
C A C G C
A G A CGCCGCAAGGCAT
C - G
C - G
A - T
G - C
A - T
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |