| Sequence ID | >W1610752167 |
| Genome ID | LNDB01000001 |
| Phylum/Class | Bacillota |
| Species | Candidatus Dichloromethanomonas elyunquensis RM [LNDB] |
| Start position on genome | 205244 |
| End posion on genome | 205169 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
catttacttg |
| tRNA gene sequence |
GTGGATGTGGCGAAGTGGTTAACGCACCGGATTGTGGCTCCGGCACTCGTGGGTTCAAGT |
| Downstream region at tRNA end position |
taatgatatt |
| Secondary structure (Cloverleaf model) | >W1610752167 His GTG
g CCCA taatgatatt
G - C
T - A
G - C
G + T
A - T
T - A
G - C T G
T T A C C C A
T G A G + | | | | A
G A G C G G T G G G C
G | | | T T
T A C G C
T A A CACTC
C - G
C - G
G - C
G - C
A - T
T C
T G
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |