Sequence ID | >W1610765940 |
Genome ID | LNOJ01000025 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Elizabethkingia bruuniana 3 [LNOJ] |
Start position on genome | 129342 |
End posion on genome | 129432 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aaccgcaatt |
tRNA gene sequence |
AGAGAGGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTATACTCCAAAAGGGT |
Downstream region at tRNA end position |
aacataaaaa |
Secondary structure (Cloverleaf model) | >W1610765940 Ser GGA t GCAA aacataaaaa A - T G - C A - T G - C A - T G - C G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TATACTCCAAAAGGGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |