Sequence ID | >W1610771101 |
Genome ID | LNRW01000007 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingopyxis sp. H080 [LNRW] |
Start position on genome | 85187 |
End posion on genome | 85114 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tttggcatga |
tRNA gene sequence |
GGCCCGATGGCGGAGTGGTGACGCAGCGGATTGCAAATCCGTGCACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
gaatcctgtc |
Secondary structure (Cloverleaf model) | >W1610771101 Cys GCA a TCCA gaatcctgtc G - C G - C C - G C - G C - G G - C A - T T T T C G G C C A G A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T G A GCAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |