Sequence ID | >W1610771587 |
Genome ID | LNSH01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingopyxis sp. H081 [LNSH] |
Start position on genome | 193425 |
End posion on genome | 193349 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
taagcaatag |
tRNA gene sequence |
GCACCCATAGCTCAGCTGGATAGAGCGCTACCCTCCGAAGGTAGAGGTCTCAGGTTCGAA |
Downstream region at tRNA end position |
tccctgcctt |
Secondary structure (Cloverleaf model) | >W1610771587 Arg CCG g GCCA tccctgcctt G - C C - G A - T C - G C - G C - G A - T T A T A G T C C A C G A A | | | | | G T C T C G T C A G G C G | | | | T T G G A G C A T A G AGGTC C - G T - A A - T C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |